Review



hek293t atcc crl11268 mouse  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC hek293t atcc crl11268 mouse
    Hek293t Atcc Crl11268 Mouse, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 6880 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/4T1/pm42314650-235-30-31
    Average 99 stars, based on 6880 article reviews
    hek293t atcc crl11268 mouse - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Fluorescence:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Quantitative RT-PCR:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    shRNA:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Recombinant:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Article Title: Differentiation in the human urothelia is defined by distinct alternative polyadenylation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MCK10/DDR1 Invitrogen MA5-37672; RRID: AB_2897596 DVL3 Invitrogen PA5-115148; RRID: AB_2899784 LYPD3 Invitrogen PA5-111138; RRID: AB_2856548 DAPI Invitrogen D1306 Anti-rabbit HRP Southern Biotech #4050-1 Anti-mouse HRP Southern Biotech #1010-05 Biological samples Human ureter This paper Ureter Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Invitrogen L3000015 SE Cell Line 96-well Nucleofector Kit (960 RCT) Lonza Bioscience V4SC-1960 Critical commercial assays Dual-Luciferase® Reporter Assay System Promega E1960 TSA+Cy3 Detection Kit Akoya Biosciences NEL744001KT TSA+Cy5 Detection Kit Akoya Biosciences NEL745001KT RNAscope Multiplex Fluorescent Detection Reagents v2 ACDbio 323110 RNAscope H2O2 and Protease Plus Reagents ACDbio 322330 RNAscope Target Retrieval Reagents ACDbio 32000 RNAscope Wash Buffer Reagents ACDbio 310091 Xenium Slides & Sample Prep Reagents 10x Genomics 1000460 Xenium Decoding Consumables 10x Genomics 1000487 Xenium Decoding Reagents 10x Genomics 1000461 Xenium Stand Alone Gene Expression Panel 10x Genomics #8QH2R6 Xenium Cell Segmentation Add-on Kit 10x Genomics 1000662 Deposited data Ureter scRNA-seq data Fink et al.3 GEO: GSE184111 Urothelial cell gene and peak count matrices This paper GEO: GSE262863 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Recombinant DNA pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 AKIRIN1-P1 This paper Addgene #236018 AKIRIN1-P2 This paper Addgene #236019 ALDH5A1-P1 This paper Addgene #236020 ALDH5A1-P2 This paper Addgene #236021 DNM1L-P1 This paper Addgene #236022 DNM1L-P2 This paper Addgene #236023 (Continued on next page) Cell Reports 45, 116839, January 27, 2026 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNM1L-P3 This paper Addgene #236024 DVL3-P1 This paper Addgene #236025 DVL3-P2 This paper Addgene #236026 ESYT2-P1 This paper Addgene #236027 ESYT2-P2 This paper Addgene #236028 HRH1-P1 This paper Addgene #236029 HRH1-P2 This paper Addgene #236030 ITGB6-P1 This paper Addgene #236031 ITGB6-P3 This paper Addgene #236032 IVNS1ABP-P1 This paper Addgene #236301 IVNS1ABP-P2 This paper Addgene #236302 IVNS1ABP-P3 This paper Addgene #236303 NKIRAS2-P1 This paper Addgene #236304 NKIRAS2-P2 This paper Addgene #236305 NOL12-P1 This paper Addgene #236306 NOL12-P2 This paper Addgene #236307 PLEKHA2-P1 This paper Addgene #236308 PLEKHA2-P2 This paper Addgene #236309 PMF1-P1 This paper Addgene #236310 PMF1-P2 This paper Addgene #236311 PTK6-P1 This paper Addgene #236312 PTK6-P2 This paper Addgene #236313 PTK6-P3 This paper Addgene #236314 RPS6KA3-P1 This paper Addgene #236315 RPS6KA3-P3 This paper Addgene #236316 SPINT1-P1 This paper Addgene #236317 SPINT1-P2 This paper Addgene #236318 SPINT1-P3 This paper Addgene #236319 TCTA-P1 This paper Addgene #236320 TCTA-P2 This paper Addgene #236321 C4orf19-P1 This paper Addgene #236322 C4orf19-P2 This paper Addgene #236323 C6orf89-P1 This paper Addgene #236324 C6orf89-P2 This paper Addgene #236325 C6orf89-P3 This paper Addgene #236326 DDR1-P1 This paper Addgene #236327 DDR1-P2 This paper Addgene #236328 METTL3-P1 This paper Addgene #237825 METTL3-P2 This paper Addgene #237826 MFSD11-P1 This paper Addgene #237827 MFSD11-P2 This paper Addgene #237828 NABP1-P1 This paper Addgene #237829 NABP1-P2 This paper Addgene #237830 NABP1-P3 This paper Addgene #237831 NAGA-P1 This paper Addgene #237832 NAGA-P2 This paper Addgene #237833 NCOA7-P1 This paper Addgene #237834 NCOA7-P2 This paper Addgene #237835 OPTN-P1 This paper Addgene #237836 (Continued on next page) 14 Cell Reports 45, 116839, January 27, 2026

    Plasmid Preparation:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Software:

    Article Title: YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression.
    Article Snippet: Article YTHDC1 lactylation regulates its phase separation to enhance target mRNA stability and promote RCC progression Graphical abstract Highlights • Quantitative lactylome analysis reveals hyperlactylated proteins under hypoxia • Hypoxia induces p300-mediated YTHDC1 K82 lactylation to drive RCC progression • K82-lactylated YTHDC1 enhances phase-separated condensate formation • Condensates protect oncogenic mRNAs from degradation by the PAXT complex Authors Chenyun Dai (戴晨昀), Yuangui Tang (唐 元桧), Huihui Yang (杨慧惠), Junfang Zheng (郑君芳) Correspondence zhengjf@ccmu.edu.cn In brief Dai et al. find that hypoxia induces protein hyperlactylation in renal cell carcinoma (RCC). p300-mediated YTHDC1 K82 lactylation promotes the expansion of phase-separated condensates.. These condensates protect oncogenic BCL2 and E2F2 mRNAs from degradation by the PAXT complex to drive RCC progression.. Dai et al., 2025, Molecular Cell 85, 2733–2748 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.06.017 ll

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    Article Title: Targeting the CD40 costimulatory receptor to improve virotherapy efficacy in diffuse midline gliomas
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PLX3397 MedChemExpress Cat#HY-16749 Beetle Luciferin Potassium Salt Promega Cat#E1601 VPD450 BD Bioscience Cat#562158 Promofluor 840 Deltaclon Cat#1402 hgp100 GenScript Cat#RP20344 FTY700 Sigma-Aldrich Cat#162359-56-0 Critical commercial assays Legendplex mouse inflammation BioLegend Cat#740150 Legendplex mouse pro-inflammatory chemokine BioLegend Cat#740007 IFN-y ELISPOT BD Bioscience Cat#551083 RNeasy Mini Kit Qiagen Cat#74104 Deposited data RNAseq raw This paper GSE292938 Experimental models: Cell lines Murine DIPG: XFM Laboratory of Dr. Oren Becher N/A Murine DIPG: NP53-mCherry Laboratory of Dr. Marta Alonso N/A Murine DIPG: XFM-luc Laboratory of Dr. Marta Alonso N/A Murine DIPG: UC-BL6-C7 Laboratory of Dr. Timothy N. Phoenix N/A Murine DIPG: UC-BL6-C7-Tomato Laboratory of Dr. Marta Alonso N/A Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: BALB/cJ The Jackson Laboratory JAX: 000651 Mouse: C57Bl/6J The Jackson Laboratory JAX: 000664 Mouse: B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J The Jackson Laboratory JAX: 005023 Mouse: B6.129S(C)-Batf3tm1Kmm/J The Jackson Laboratory JAX: 013755 Software and algorithms PhotonIMAGER Optima system BioscpaceLab N/A Aperio ImageScope Leica Biosystems N/A ImageJ Schneider et al. 60 https://imagej.nih.gov/ij/ FlowJo 10.8.1 BD Bioscience N/A QuPath version 0.2.3 University of Edinburgh N/A R/Bioconductor Bioconductor N/A R 3.6.0 Posit N/A Legendplex analysis Software V8.0 Vigine Tech Inc N/A FastQC version 0.11.8 Babraham Bioinformatics N/A Trimmomatic version 0.38 Bolger, Anthony M et al. 61 N/A Subread version 1.6.3 Subread N/A EdgeR version 3.40.2 Bioconductor N/A ClusterProfile R package Bioconductor N/A Prism software 10 GraphPad by Domatics N/A BioRender BioRender N/A Cell Reports Medicine 6, 102204, July 15, 2025 e2 Article ll OPEN ACCESS the Center for Applied Medical Research animal facility (Pamplona, Spain). ..

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Transfection:

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    RNA sequencing:

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    Article Title: Targeting the CD40 costimulatory receptor to improve virotherapy efficacy in diffuse midline gliomas
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PLX3397 MedChemExpress Cat#HY-16749 Beetle Luciferin Potassium Salt Promega Cat#E1601 VPD450 BD Bioscience Cat#562158 Promofluor 840 Deltaclon Cat#1402 hgp100 GenScript Cat#RP20344 FTY700 Sigma-Aldrich Cat#162359-56-0 Critical commercial assays Legendplex mouse inflammation BioLegend Cat#740150 Legendplex mouse pro-inflammatory chemokine BioLegend Cat#740007 IFN-y ELISPOT BD Bioscience Cat#551083 RNeasy Mini Kit Qiagen Cat#74104 Deposited data RNAseq raw This paper GSE292938 Experimental models: Cell lines Murine DIPG: XFM Laboratory of Dr. Oren Becher N/A Murine DIPG: NP53-mCherry Laboratory of Dr. Marta Alonso N/A Murine DIPG: XFM-luc Laboratory of Dr. Marta Alonso N/A Murine DIPG: UC-BL6-C7 Laboratory of Dr. Timothy N. Phoenix N/A Murine DIPG: UC-BL6-C7-Tomato Laboratory of Dr. Marta Alonso N/A Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: BALB/cJ The Jackson Laboratory JAX: 000651 Mouse: C57Bl/6J The Jackson Laboratory JAX: 000664 Mouse: B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J The Jackson Laboratory JAX: 005023 Mouse: B6.129S(C)-Batf3tm1Kmm/J The Jackson Laboratory JAX: 013755 Software and algorithms PhotonIMAGER Optima system BioscpaceLab N/A Aperio ImageScope Leica Biosystems N/A ImageJ Schneider et al. 60 https://imagej.nih.gov/ij/ FlowJo 10.8.1 BD Bioscience N/A QuPath version 0.2.3 University of Edinburgh N/A R/Bioconductor Bioconductor N/A R 3.6.0 Posit N/A Legendplex analysis Software V8.0 Vigine Tech Inc N/A FastQC version 0.11.8 Babraham Bioinformatics N/A Trimmomatic version 0.38 Bolger, Anthony M et al. 61 N/A Subread version 1.6.3 Subread N/A EdgeR version 3.40.2 Bioconductor N/A ClusterProfile R package Bioconductor N/A Prism software 10 GraphPad by Domatics N/A BioRender BioRender N/A Cell Reports Medicine 6, 102204, July 15, 2025 e2 Article ll OPEN ACCESS the Center for Applied Medical Research animal facility (Pamplona, Spain). ..

    Gene Expression:

    Article Title: TRPM3 mediates spontaneous pain and mechanical allodynia in a mouse model of chronic orofacial neuropathy.
    Article Snippet: .. They were housed in standard plastic mice cages (2–5 mice per cage) in a colony room with a room temperature of 21 ± 1 ◦ C, a relative REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SPRR1A antibody (rabbit) Novus Biologicals Cat# NBP2-93464; RRID: AB_3463407 Anti-Calbindin 2 antibody (rabbit) Abcam Cat# ab108404; RRID: AB_10861236 Anti-PGP9.5 antibody (rabbit) Dako Cat# Z5116; RRID; AB_2622233 Biotinylated pig anti-rabbit Dako Cat# E0353; RRID: AB_2737292 Anti-Rabbit Immunoglobulins/HRP (goat) Dako Cat# P0448; RRID: AB_2617138 Chemicals, peptides, and recombinant proteins Isosakuranetin PhytoLab N/A Primidone Sigma-Aldrich P7423 Carbamazepine Sigma-Aldrich C4024 Mavatrep Sanbio HY-16935-100 Tween80 Sigma-Aldrich P4780 λ-carrageenan TCI C2871 Hematoxylin & Eosin (H&E) Sigma-Aldrich HHS16 TransIT-LT1 transfection reagent Mirus Bio MIR 2306 Critical commercial assays innuPREP RNA Mini Kit 2.0 Innuscreen GmbH 845-KS-2040250 Deposited data Bulk RNAseq data of trigeminal ganglia This paper Gene Expression Omnibus (GEO) repository: GSE316925 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Wild type C57Bl/6J mice (10-week old) Jackson Laboratory JAX: 000664 Trpm3 − /− C57Bl/6J mice (10-week old) Vriens et al. 24 N/A Recombinant DNA Plasmid: pCAGGSM2-hTRPM3-Ires-GFP Burglen et al. 82 N/A Plasmid: pCAGGSM2-hTRPM3(A1657V)-Ires-GFP This paper N/A Software and algorithms Origin OriginLab Corporation OriginPro 2023b STAR aligner GitHub v2.7.10b RSEM GitHub v1.3.1 DESeq2 Bioconductor v1.44.0 DOSE Bioconductor v4.0.0 enrichplot Bioconductor v1.26.6 QuPath GitHub V0.5.1 PatchMasterPro HEKA Elektronik V2x92 Other Chromic catgut ligatures (6-0) Ethicon 1836G Vicryl Rapide sutures (6-0) Ethicon W9911 e1 Cell Reports Medicine 7, 102645, March 17, 2026 OPEN ACCESS humidity of 40 ± 10% and a 12h light/hour dark cycle. ..

    Reverse Transcription:

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Sequencing:

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Polymerase Chain Reaction:

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Nanopore Sequencing:

    Article Title: Host-transposon mutualism supports regeneration in planarians.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal B-IAP This paper N/A Mouse monoclonal anti-FLAG Sigma-Aldrich Cat#F1804; RRID: AB_262044 Rabbit polyclonal anti-HA Abcam Cat#ab9110; RRID: 307019 Rabbit polyclonal anti-caspase-3 Abcam Cat#ab13847; RRID: 443014 Mouse anti-α-tubulin Millipore Cat#MABT205; RRID: AB_11204167 Mouse anti-actin Millipore Cat#MABT825; RRID: AB_2571580 Mouse monoclonal anti-Rabbit IgG, HRP Cell Signaling Technology Cat#5127S; RRID: AB_10892860 Rat monoclonal anti-mouse IgG, HRP Abcam Cat#ab131368; RRID: AB_2895114 Mouse Normal IgG Cell Signaling Technology Cat#5415S; RRID: AB_10829607 Goat polyclonal anti-Rabbit IgG, HRP Abcam Cat#ab6721; RRID: AB_955447 Goat polyclonal anti-Mouse IgG, HRP Abcam Cat#ab6789; RRID: AB_955439 Sheep polyclonal anti-DIG-POD Roche Cat#11207733910; RRID: AB_514500 Sheep polyclonal anti-Fl-POD Roche Cat#11426346910; RRID: AB_840257 Rat monoclonal anti-DNP-HRP Perkin Elmer Cat#FP1129; RRID: AB_2629439 Bacterial and virus strains DH10B F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara,leu)7697 araD139 galU galK nupG rpsL λ– New England Biolabs Cat#C3019I BL12 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdSλ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 New England Biolabs Cat#C2530H Chemicals, peptides, and recombinant proteins Actinomycin-D (Act-D) Sigma-Aldrich Cat#A1410 Ampure XP beads Beckman Coulter Cat#A63881 Anti-FLAG® M2 Magnetic Beads Sigma-Aldrich Cat#M8823 Benzamidine Separopore 6B bioWORLD Cat#20181111-2 c0mplete Mini, EDTA-free Roche Cat#11836170001 cyclohexamide Sigma-Aldrich Cat#1810 Digoxigenin-11-dUTP Roche Cat#11093088910 DMEM, high glucose, pyruvate GIBCO Cat#11995065 DMSO New England Biolabs Cat#B0515A DNaseI New England Biolabs Cat#M0303S DPBS GIBCO Cat#14190-144 DTT ThermoFisher Cat#BP17225 Enoxacin ThermoFisher Cat#J61912.06 EvaGreen New England Biolabs Cat#1725213 Fetal bovine serum Sigma-Aldrich Cat#F0926 Formaldehyde ThermoFisher Cat#119690010 Formamide (deionized) Ambion Cat#AM9344 Gentamicin Sulfate Salt Sigma-Aldrich Cat#G1264-1G glutathione-sepharose beads ThermoFisher Cat#16101 Hydrogen Peroxide Sigma-Aldrich Cat#7722-44-1 L-glutamine GIBCO Cat#25030-081 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–15.e1–e7, May 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER LongAmp Taq 2XMaster Mix New England Biolabs Cat#M0287 Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0752 2-Mercaptoethanol Sigma-Aldrich Cat#M3148 Pen-strep GIBCO Cat#15140-122 PMSF MP Biomedicals Cat#219538105 Polyethylenimine (PEI) Kyfora Bio Cat#23966-100 Proteinase K Invitrogen Cat#25530049 Protoscript II RT New England Biolabs Cat#M0368L RNaseH New England Biolabs Cat#M0297L Scal-HF New England Biolabs Cat#R3122S Terminal Transferase New England Biolabs Cat#M0315S Triton X-100 Sigma-Aldrich Cat#SLBW6852 Trizol Life Technologies (ambion) Cat#15596018 Trypsin-EDTA Invitrogen Cat#25300-054 Tween-20 Sigma-Aldrich Cat#P7949 Critical commercial assays Ac-YVAD-AFC Cayman Cat#17591 Ac-IETD-AFC Cayman Cat#17480 Ac-LEHD-AFC Cayman Cat#17051 Caspase 3 Detection Kit Abcam Cat#ab102491 cDNA-PCR sequencing Kit Oxford Nanopore Cat#SQK-PCS109 Monarch® Plasmid Miniprep Kit New England Biolabs Cat#T1110L Nucleospin Gel and PCR Clean-up kit Machery-Nagel Cat#740609 Deposited data Regeneration data re-processed (Figures S2I and S3E) Wurtzel et al.57 PRJNA276084 Planarian transcriptomic data re-processed (discussion) Vila-Farre et al.83 PRJNA1011852 Nanopore sequencing data This paper PRJNA1135975 Schmidtea mediterranea genome Ivankovic et al.89 Planmine90 Dugesia japonica genome An et al.91 http://www.planarian.jp Genome and Transcriptomes This paper see Table S2 Western blots This paper Mendeley: 10.17632/8gk5ssdtvp.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains S. mediterranea: asexual CIW4 clonal line Lab stock N/A Oligonucleotides primers This paper see Table S1 Recombinant DNA pGEM-T Promega Cat#A3600 pCDNA 3.1 ThermoFisher Cat#V790-20 pCMV3flag8HOIL-1L Fu et al.92 Addgene Cat#50016 pGEX-XIAP Yang et al.93 Addgene Cat#8340 pGEM-Gypsy8 This Paper N/A pGEM-BURRO2 This Paper N/A pGEM-B1-5’MATH This Paper N/A pGEM-SLF9 This Paper N/A pGEM-BURRO1-IAP This Paper N/A (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–15.e1–e7, May 13, 2026 e2 ..

    other:

    Article Title: IAP-based biodegraders can convert necroptosis to apoptosis and eliminate cancer driving protein complexes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Birinapant TetraLogic Pharmaceuticals, Benetatos et al.84 N/A Smac-mimetic Compound A (Cp.A) TetraLogic Pharmaceuticals, Vince et al.28 N/A XB2d89 Genentech, Goncharov et al.73 N/A ACBI1 Boehringer Ingelheim (opnMe), Farnaby et al.85 N/A cis ACBI1 Boehringer Ingelheim (opnMe), Farnaby et al.85 N/A PS341 Genesearch Cat# HB4036 TAK243 MedChemExpress Cat# HY-100487 MG-132 Sigma-Aldrich Cat# M7449 IDN-6556 TetraLogic Pharmaceuticals N/A Cycloheximide (CHX) Sigma-Aldrich Cat# C7698 Lipofectamine 3000 Thermo Fisher Cat# L3000008 Puromycin InvivoGen Cat# ant-pr-1 SPY505-DNA probe Spirochrome Cat# SPY505-DNA SPY620-DNA probe Spirochrome Cat# SPY620-DNA SPY700-DNA probe Spirochrome Cat# SPY700-DNA SYTOX Green Nucleic Acid Stain Thermo Fisher Cat# S7020 Propidium iodide Sigma-Aldrich Cat# P4170 Deposited data Mass spectrometry proteomics data This paper PRIDE: PXD061128 Experimental models: Cell lines Human: HT29 ATCC HTB-38 Human: U937 ATCC CRL-1593.2 Human: MDA-MB-231 ATCC HTB-26 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: NOD-SCID-IL2Rγc− /− female mice WEHI breeding facility NODSCIDIL2r/J (GM) Oligonucleotides Human BIRC2 (cIAP1) crRNA Sequence 1: ATGCTATGTCAGAACACCGG IDT N/A Human BIRC2 (cIAP1) crRNA Sequence 2: ACATATTCAACTTTCCCCGC IDT N/A Human BIRC3 (cIAP2) crRNA Sequence 1: ATTGAGCAATTGGGAACCGA IDT N/A Human BIRC3 (cIAP2) crRNA Sequence 2: ATTGAGCAATTGGGAACCGA IDT N/A Human XIAP crRNA Sequence 1: TATCAGACACCATATACCCG IDT N/A Human XIAP crRNA Sequence 2: AGTGCTGGACTCTACTACAC IDT N/A Recombinant DNA See Table S1 for plasmids and sequences of all constructs Software and algorithms Software: Prism GraphPad Software https://www.graphpad.com/ Software: Fiji ImageJ https://imagej.net/Fiji Software: Image Lab (Version 6.1.0) Bio-Rad https://www.bio-rad.com ll OPEN ACCESS Resource e2 Cell Chemical Biology 33, 1–18.e1–e5, April 16, 2026

    Enzyme-linked Immunospot:

    Article Title: Targeting the CD40 costimulatory receptor to improve virotherapy efficacy in diffuse midline gliomas
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PLX3397 MedChemExpress Cat#HY-16749 Beetle Luciferin Potassium Salt Promega Cat#E1601 VPD450 BD Bioscience Cat#562158 Promofluor 840 Deltaclon Cat#1402 hgp100 GenScript Cat#RP20344 FTY700 Sigma-Aldrich Cat#162359-56-0 Critical commercial assays Legendplex mouse inflammation BioLegend Cat#740150 Legendplex mouse pro-inflammatory chemokine BioLegend Cat#740007 IFN-y ELISPOT BD Bioscience Cat#551083 RNeasy Mini Kit Qiagen Cat#74104 Deposited data RNAseq raw This paper GSE292938 Experimental models: Cell lines Murine DIPG: XFM Laboratory of Dr. Oren Becher N/A Murine DIPG: NP53-mCherry Laboratory of Dr. Marta Alonso N/A Murine DIPG: XFM-luc Laboratory of Dr. Marta Alonso N/A Murine DIPG: UC-BL6-C7 Laboratory of Dr. Timothy N. Phoenix N/A Murine DIPG: UC-BL6-C7-Tomato Laboratory of Dr. Marta Alonso N/A Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: BALB/cJ The Jackson Laboratory JAX: 000651 Mouse: C57Bl/6J The Jackson Laboratory JAX: 000664 Mouse: B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J The Jackson Laboratory JAX: 005023 Mouse: B6.129S(C)-Batf3tm1Kmm/J The Jackson Laboratory JAX: 013755 Software and algorithms PhotonIMAGER Optima system BioscpaceLab N/A Aperio ImageScope Leica Biosystems N/A ImageJ Schneider et al. 60 https://imagej.nih.gov/ij/ FlowJo 10.8.1 BD Bioscience N/A QuPath version 0.2.3 University of Edinburgh N/A R/Bioconductor Bioconductor N/A R 3.6.0 Posit N/A Legendplex analysis Software V8.0 Vigine Tech Inc N/A FastQC version 0.11.8 Babraham Bioinformatics N/A Trimmomatic version 0.38 Bolger, Anthony M et al. 61 N/A Subread version 1.6.3 Subread N/A EdgeR version 3.40.2 Bioconductor N/A ClusterProfile R package Bioconductor N/A Prism software 10 GraphPad by Domatics N/A BioRender BioRender N/A Cell Reports Medicine 6, 102204, July 15, 2025 e2 Article ll OPEN ACCESS the Center for Applied Medical Research animal facility (Pamplona, Spain). ..

    Purification:

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Single Cell:

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Chromatin Immunoprecipitation:

    Article Title: CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samples.
    Article Snippet: Cas9 Nuclease V3 IDT Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer IDT Cat # 1075915 BsmBI-v2 NEB Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells STEMCELL Technology Cat # H4434 T4 DNA ligase NEB M0202L T7 DNA ligase NEB M0318L PEG-8000 Sigma-Aldrich P2139 Busulfan Meitheal NDC 71288-116-11 sparQ PureMag Beads Quantabio/VWR 95196-060 KAPA HiFi HotStart ReadyMix Roche 07958935001 DNase I Sigma-Aldrich AMPD1-1KT Critical commercial assays In-Fusion HD Cloning Kit Takara Bio 638909 2x Phusion Master Mix Thermo Scientific F-548 (Continued on next page) e1 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Direct-zol RNA Miniprep Plus Zymo Research R2072 Agilent High Sensitivity DNA Kit Agilent 5067-4626 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Miniprep Kit ZYMO Research D3025 NucleoSpin Gel and PCR Clean-up Mini Kit Macherey-Nagel 740609.250 NEBNext® Library Quant Kit for Illumina NEB E7630 Qubit dsDNA HS assay kit InvitrogenTM Q33231 Chromium Next GEM Single Cell 5’ Reagent Kits v2 10x Genomics PN-1000263 qScript cDNA SuperMix VWR 101414-106 Dead cell removal kit Miltenyi Biotec 130-090-101 Deposited data scRNA-seq/Perturb-seq data This study GEO: GSE221578 scRNA-seq/scATAC-Seq data Chen et al. 55 https://data.humantumoratlas.org/ Healthy donor scRNA-seq Granja et al. 67 GEO: GSE139369 ATAC-seq Corces et al. 56 GEO: GSE74912 Pediatric AML H3K27ac ChIP-seq Perez et al. 78 GEO: GSE155558 B-ALL H3K27ac ChIP-seq Saint Fleur-Lominy et al. 79 GEO: GSE156563 AML H3K27ac CUT&Tag Xu et al. 80 GEO: GSE152136 Experimental models: Cell lines Human: MOLM-13 DSMZ ACC-554 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains NSG JAX Stock #: 005557 NSGS JAX Strain #:013062 Oligonucleotides sgRNA sequences included in the study This study Table S4 Recombinant DNA LRG2.1 Addgene 108098 SFFV-Cas9-2A-mCherry Addgene 251397 SFFV-KRAB-dCas9-2A-mCherry This study N/A SFFV-KRAB(W8E)-dCas9-2A-mCherry This study N/A SFFV-ZIM3-dCas9-2A-mCherry Addgene 251398 dCas9-KRAB-mCherry Addgene 163956 pLX303-ZIM3-KRAB-dCas9 Addgene 154472 LRG Addgene 65656 Software and algorithms MAGeCK v0.5.0+9 Li et al. 44 https://sourceforge.net/p/mageck/wiki/Home/ Cell Ranger version 6.1.2 10x Genomics https://github.com/10XGenomics/cellranger R version 4.4.0 R Core Team https://www.r-project.org FlowJo software, v10.0.7 FlowJo N/A Seurat version 4.1.1 Github https://github.com/satijalab/seurat msigdb (v 7.1) GSEA https://www.gsea-msigdb.org/gsea/msigdb ggplot2 (v 3.5.1) R https://cran.r-project.org/web/packages/ggplot2/ index.html ClusterProfiler (v 4.10.0) R Bioconductor https://bioconductor.org/packages/release/bioc/ html/clusterProfiler.html GraphPad Prism 9 GraphPad Software N/A Other Codes used in this study This study Zenodo: 10.5281/zenodo.18176272 Molecular Cell 86, 968–985.e1–e7, March 5, 2026 e2 .. Cell line and patient-derived cell culture All cell lines were purchased from ATCC, DMSZ, or JCRB.

    Protease Inhibitor:

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Cloning:

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Luciferase:

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Reporter Gene Assay:

    Article Title: Synergistic degradation of circular RNAs by RNAseK and lysosome.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Puromycin Solarbio Cat# P8230 cOmpleteTM protease inhibitor Tablet Roche Cat# 04693132001 RNasin® Ribonuclease Inhibitor Promega Cat# N2511 T4 RNA Ligase 1 NEB Cat# M0204 3×FLAG peptide MCE Cat# HY-P0319 Proteinase K Invitrogen Cat# 25530049 EU Ribobio Cat# C00065 Biotin-azide Ribobio Cat# C00101 Hoechst 33342 Invitrogen Cat# H21492 DQ-BSA ShareBio Cat# D-12051SB Human RNase 1 (His) MCE Cat# HY-P71089 Human WT RNAseK (FLAG) This study N/A Human K10A RNAseK (FLAG) This study N/A Critical commercial assays GoScript Reverse Transcription System Promega Cat# A5001 ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 Clarity Western ECL Substrate BIO-RAD Cat# 1705061 Transcript Aid T7 High Yield Transcription Kit Thermo Cat# K0441 Dual Luciferase Reporter Gene Assay Kit Yeasen Cat# 11402ES80 RNA Clean & Concentrator-5 Zymo Research Cat# R1013 ERCC spike-in Mix 1 kit Invitrogen Cat# 4456740 Deposited data Raw and analyzed data This study GEO: GSE288057 Original blots and images This study, Mendeley Data https://doi.org/10.17632/pzv2st58r6.1 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216; RRID: CVCL_0063 Human: HeLa ATCC CCL-2; RRID: CVCL_0030 Human: HEK293F Dr. Congzhao Zhou (USTC) N/A Mouse: N2a ATCC CCL-131; RRID: CVCL_0470 Mouse: 3T3-L1 Dr. Jian Liu (HFUT) N/A Human: EndoFLAG_RNASEK HEK293T This study N/A Human: EndoFLAG_RNASEK HeLa This study N/A Experimental models: Organisms/strains C. elegans: N2 Caenorhabditis Genetics Center WormBase ID: WBStrain00000001 C. elegans: GR1373: eri-1 (mg366) IV Caenorhabditis Genetics Center WormBase ID: WBStrain00007911 C. elegans: GSH440: hzhCR202[C46G7.1::GFP] This study N/A C. elegans: GSH441: hzhCR203[F49C12.12::GFP] This study N/A C. elegans: SJ4005: zcIs4 [Phsp-4::GFP] V Obtained from Dr. Bin Qi (YNU) WormBase ID: WBStrain00034065 C. elegans: SJ4100: zcIs13 [Phsp-6::GFP] V Obtained from Dr. Ye Tian (CAS) WormBase ID: WBStrain00034068 C. elegans: CL2070: dvIs70 [Phsp-16.2:: GFP+rol-6(su1006)] Caenorhabditis Genetics Center WormBase ID: WBStrain00005096 Oligonucleotides See Table S5 (Too many oligos to list here) This study N/A Recombinant DNA See Table S5 (Too many plasmids to list here) This study N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Graphpad Prism GraphPad Software, lnc. https://www.graphpad.com/features R The R Project https://www.r-project.org/ (Continued on next page) Cell Reports 45, 117178, April 28, 2026 15 ..

    Expressing:

    Article Title: Differentiation in the human urothelia is defined by distinct alternative polyadenylation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MCK10/DDR1 Invitrogen MA5-37672; RRID: AB_2897596 DVL3 Invitrogen PA5-115148; RRID: AB_2899784 LYPD3 Invitrogen PA5-111138; RRID: AB_2856548 DAPI Invitrogen D1306 Anti-rabbit HRP Southern Biotech #4050-1 Anti-mouse HRP Southern Biotech #1010-05 Biological samples Human ureter This paper Ureter Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Invitrogen L3000015 SE Cell Line 96-well Nucleofector Kit (960 RCT) Lonza Bioscience V4SC-1960 Critical commercial assays Dual-Luciferase® Reporter Assay System Promega E1960 TSA+Cy3 Detection Kit Akoya Biosciences NEL744001KT TSA+Cy5 Detection Kit Akoya Biosciences NEL745001KT RNAscope Multiplex Fluorescent Detection Reagents v2 ACDbio 323110 RNAscope H2O2 and Protease Plus Reagents ACDbio 322330 RNAscope Target Retrieval Reagents ACDbio 32000 RNAscope Wash Buffer Reagents ACDbio 310091 Xenium Slides & Sample Prep Reagents 10x Genomics 1000460 Xenium Decoding Consumables 10x Genomics 1000487 Xenium Decoding Reagents 10x Genomics 1000461 Xenium Stand Alone Gene Expression Panel 10x Genomics #8QH2R6 Xenium Cell Segmentation Add-on Kit 10x Genomics 1000662 Deposited data Ureter scRNA-seq data Fink et al.3 GEO: GSE184111 Urothelial cell gene and peak count matrices This paper GEO: GSE262863 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Recombinant DNA pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 AKIRIN1-P1 This paper Addgene #236018 AKIRIN1-P2 This paper Addgene #236019 ALDH5A1-P1 This paper Addgene #236020 ALDH5A1-P2 This paper Addgene #236021 DNM1L-P1 This paper Addgene #236022 DNM1L-P2 This paper Addgene #236023 (Continued on next page) Cell Reports 45, 116839, January 27, 2026 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNM1L-P3 This paper Addgene #236024 DVL3-P1 This paper Addgene #236025 DVL3-P2 This paper Addgene #236026 ESYT2-P1 This paper Addgene #236027 ESYT2-P2 This paper Addgene #236028 HRH1-P1 This paper Addgene #236029 HRH1-P2 This paper Addgene #236030 ITGB6-P1 This paper Addgene #236031 ITGB6-P3 This paper Addgene #236032 IVNS1ABP-P1 This paper Addgene #236301 IVNS1ABP-P2 This paper Addgene #236302 IVNS1ABP-P3 This paper Addgene #236303 NKIRAS2-P1 This paper Addgene #236304 NKIRAS2-P2 This paper Addgene #236305 NOL12-P1 This paper Addgene #236306 NOL12-P2 This paper Addgene #236307 PLEKHA2-P1 This paper Addgene #236308 PLEKHA2-P2 This paper Addgene #236309 PMF1-P1 This paper Addgene #236310 PMF1-P2 This paper Addgene #236311 PTK6-P1 This paper Addgene #236312 PTK6-P2 This paper Addgene #236313 PTK6-P3 This paper Addgene #236314 RPS6KA3-P1 This paper Addgene #236315 RPS6KA3-P3 This paper Addgene #236316 SPINT1-P1 This paper Addgene #236317 SPINT1-P2 This paper Addgene #236318 SPINT1-P3 This paper Addgene #236319 TCTA-P1 This paper Addgene #236320 TCTA-P2 This paper Addgene #236321 C4orf19-P1 This paper Addgene #236322 C4orf19-P2 This paper Addgene #236323 C6orf89-P1 This paper Addgene #236324 C6orf89-P2 This paper Addgene #236325 C6orf89-P3 This paper Addgene #236326 DDR1-P1 This paper Addgene #236327 DDR1-P2 This paper Addgene #236328 METTL3-P1 This paper Addgene #237825 METTL3-P2 This paper Addgene #237826 MFSD11-P1 This paper Addgene #237827 MFSD11-P2 This paper Addgene #237828 NABP1-P1 This paper Addgene #237829 NABP1-P2 This paper Addgene #237830 NABP1-P3 This paper Addgene #237831 NAGA-P1 This paper Addgene #237832 NAGA-P2 This paper Addgene #237833 NCOA7-P1 This paper Addgene #237834 NCOA7-P2 This paper Addgene #237835 OPTN-P1 This paper Addgene #237836 (Continued on next page) 14 Cell Reports 45, 116839, January 27, 2026



    Similar Products

    99
    ATCC hek293t atcc crl11268 mouse
    Hek293t Atcc Crl11268 Mouse, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/4T1/pm42314650-235-30-31
    Average 99 stars, based on 1 article reviews
    hek293t atcc crl11268 mouse - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC raw264 7 atcc sc 6003 hek293t atcc crl 3216 hela hsting 110 gfp cells
    Raw264 7 Atcc Sc 6003 Hek293t Atcc Crl 3216 Hela Hsting 110 Gfp Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42313565-218-0-1
    Average 99 stars, based on 1 article reviews
    raw264 7 atcc sc 6003 hek293t atcc crl 3216 hela hsting 110 gfp cells - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models
    Cell Lines Hek293t Cells Atcc Crl3216 H Vegf Reporter 293 Cell Line Genomeditech Gm C09057 Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42285094-518-7-11
    Average 99 stars, based on 1 article reviews
    cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    97
    ATCC crl 3213 hek293t atcc
    Crl 3213 Hek293t Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/Phoenix-AMPHO/pm42284146-232-173-175
    Average 97 stars, based on 1 article reviews
    crl 3213 hek293t atcc - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293t atcc crl
    Cell Lines Hek293t Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42263678-218-161-164
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293t atcc crl 3216 oligonucleotides primer
    Cell Lines Hek293t Atcc Crl 3216 Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42268722-64-87-90
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl 3216 oligonucleotides primer - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC gm01650 hek293t cells atcc crl
    Gm01650 Hek293t Cells Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42259290-191-192-195
    Average 99 stars, based on 1 article reviews
    gm01650 hek293t cells atcc crl - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC hek293t cells atcc cat
    Hek293t Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T%2F17/10__1016_slash_j__isci__2026__116022-200-114-116
    Average 99 stars, based on 1 article reviews
    hek293t cells atcc cat - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293t atcc crl 3216
    Cell Lines Hek293t Atcc Crl 3216, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/pm42228573-267-142-145
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl 3216 - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    ATCC hek293t cells atcc crl 3216 rat
    Hek293t Cells Atcc Crl 3216 Rat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hek293t+atcc+crl/293T/10__1016_slash_j__isci__2026__116288-249-252-254
    Average 99 stars, based on 1 article reviews
    hek293t cells atcc crl 3216 rat - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results